merge-update from trunk
authorPatric Plitzner <p.plitzner@bgbm.org>
Mon, 27 Oct 2014 13:45:51 +0000 (13:45 +0000)
committerPatric Plitzner <p.plitzner@bgbm.org>
Mon, 27 Oct 2014 13:45:51 +0000 (13:45 +0000)
1  2 
.gitattributes
eu.etaxonomy.taxeditor.editor/META-INF/MANIFEST.MF
eu.etaxonomy.taxeditor.editor/plugin.xml
eu.etaxonomy.taxeditor.editor/src/main/java/eu/etaxonomy/taxeditor/editor/molecular/AlignmentEditor.java

diff --combined .gitattributes
index 602aaca4f08bfb72d12850cf13c115a07ebc3382,7955a88cd84bc5e97af2e4ead816ffb273b0a174..b784f78f8a5a880c0f409c51759c8a9355a7591c
@@@ -358,11 -358,6 +358,11 @@@ eu.etaxonomy.taxeditor.editor/icons/edi
  eu.etaxonomy.taxeditor.editor/icons/emblem-photos.png -text
  eu.etaxonomy.taxeditor.editor/icons/leaf_detail.png -text
  eu.etaxonomy.taxeditor.editor/icons/xper64.png -text
 +eu.etaxonomy.taxeditor.editor/lib/biojava3-alignment-3.0.7.jar -text
 +eu.etaxonomy.taxeditor.editor/lib/biojava3-core-3.0.7.jar -text
 +eu.etaxonomy.taxeditor.editor/lib/commons-lang3-3.1.jar -text
 +eu.etaxonomy.taxeditor.editor/lib/core-1.8.5.jar -text
 +eu.etaxonomy.taxeditor.editor/lib/sequencing-1.8.5.jar -text
  eu.etaxonomy.taxeditor.editor/p2.inf -text
  eu.etaxonomy.taxeditor.editor/plugin.xml -text
  eu.etaxonomy.taxeditor.editor/pom.xml -text
@@@ -386,10 -381,7 +386,10 @@@ eu.etaxonomy.taxeditor.editor/src/main/
  eu.etaxonomy.taxeditor.editor/src/main/java/eu/etaxonomy/taxeditor/editor/group/authority/CdmAuthorityEditor.java -text
  eu.etaxonomy.taxeditor.editor/src/main/java/eu/etaxonomy/taxeditor/editor/group/authority/CdmAuthorityEditorInput.java -text
  eu.etaxonomy.taxeditor.editor/src/main/java/eu/etaxonomy/taxeditor/editor/group/authority/handler/EditCdmAuthoritiesHandler.java -text
 +eu.etaxonomy.taxeditor.editor/src/main/java/eu/etaxonomy/taxeditor/editor/handler/AddAHandler.java -text
  eu.etaxonomy.taxeditor.editor/src/main/java/eu/etaxonomy/taxeditor/editor/handler/EditNewTaxonHandler.java -text
 +eu.etaxonomy.taxeditor.editor/src/main/java/eu/etaxonomy/taxeditor/editor/handler/LoadPherogramHandler.java -text
 +eu.etaxonomy.taxeditor.editor/src/main/java/eu/etaxonomy/taxeditor/editor/handler/OpenAlignmentEditor.java -text
  eu.etaxonomy.taxeditor.editor/src/main/java/eu/etaxonomy/taxeditor/editor/handler/OpenChecklistEditorHandler.java -text
  eu.etaxonomy.taxeditor.editor/src/main/java/eu/etaxonomy/taxeditor/editor/handler/OpenDerivateViewHandler.java -text
  eu.etaxonomy.taxeditor.editor/src/main/java/eu/etaxonomy/taxeditor/editor/handler/OpenParentHandler.java -text
@@@ -422,10 -414,6 +422,10 @@@ eu.etaxonomy.taxeditor.editor/src/main/
  eu.etaxonomy.taxeditor.editor/src/main/java/eu/etaxonomy/taxeditor/editor/key/polytomous/operation/CreateNodeOperation.java -text
  eu.etaxonomy.taxeditor.editor/src/main/java/eu/etaxonomy/taxeditor/editor/key/polytomous/operation/DeleteNodeOperation.java -text
  eu.etaxonomy.taxeditor.editor/src/main/java/eu/etaxonomy/taxeditor/editor/key/polytomous/operation/RefreshNodeNumberingOperation.java -text
 +eu.etaxonomy.taxeditor.editor/src/main/java/eu/etaxonomy/taxeditor/editor/molecular/AlignmentEditor.java -text
 +eu.etaxonomy.taxeditor.editor/src/main/java/eu/etaxonomy/taxeditor/editor/molecular/AlignmentEditorInput.java -text
 +eu.etaxonomy.taxeditor.editor/src/main/java/eu/etaxonomy/taxeditor/editor/molecular/CMDAlignmentObjectPlaceholder.java -text
 +eu.etaxonomy.taxeditor.editor/src/main/java/eu/etaxonomy/taxeditor/editor/molecular/ContigSequenceDataProvider.java -text
  eu.etaxonomy.taxeditor.editor/src/main/java/eu/etaxonomy/taxeditor/editor/name/TaxonNameEditor.java -text
  eu.etaxonomy.taxeditor.editor/src/main/java/eu/etaxonomy/taxeditor/editor/name/container/AbstractGroup.java -text
  eu.etaxonomy.taxeditor.editor/src/main/java/eu/etaxonomy/taxeditor/editor/name/container/AbstractGroupedContainer.java -text
@@@ -548,6 -536,8 +548,8 @@@ eu.etaxonomy.taxeditor.editor/src/main/
  eu.etaxonomy.taxeditor.editor/src/main/java/eu/etaxonomy/taxeditor/editor/view/derivate/contextMenu/CreateDerivateContextMenu.java -text
  eu.etaxonomy.taxeditor.editor/src/main/java/eu/etaxonomy/taxeditor/editor/view/derivate/contextMenu/DerivateViewContextMenu.java -text
  eu.etaxonomy.taxeditor.editor/src/main/java/eu/etaxonomy/taxeditor/editor/view/derivate/contextMenu/SingleReadSequenceContextMenu.java -text
+ eu.etaxonomy.taxeditor.editor/src/main/java/eu/etaxonomy/taxeditor/editor/view/derivate/handler/DeleteDerivateHandler.java -text
+ eu.etaxonomy.taxeditor.editor/src/main/java/eu/etaxonomy/taxeditor/editor/view/derivate/operation/DeleteDerivateOperation.java -text
  eu.etaxonomy.taxeditor.editor/src/main/java/eu/etaxonomy/taxeditor/editor/view/descriptive/DescriptionElementDragListener.java -text
  eu.etaxonomy.taxeditor.editor/src/main/java/eu/etaxonomy/taxeditor/editor/view/descriptive/DescriptionElementDropAdapter.java -text
  eu.etaxonomy.taxeditor.editor/src/main/java/eu/etaxonomy/taxeditor/editor/view/descriptive/DescriptionElementTransfer.java -text
@@@ -595,10 -585,7 +597,10 @@@ eu.etaxonomy.taxeditor.editor/src/main/
  eu.etaxonomy.taxeditor.editor/src/main/java/eu/etaxonomy/taxeditor/editor/view/uses/operation/CreateTaxonUseOperation.java -text
  eu.etaxonomy.taxeditor.editor/src/main/java/eu/etaxonomy/taxeditor/editor/view/uses/operation/CreateUseRecordOperation.java -text
  eu.etaxonomy.taxeditor.editor/src/main/java/eu/etaxonomy/taxeditor/editor/view/uses/operation/CreateUseSummaryOperation.java -text
 +eu.etaxonomy.taxeditor.editor/src/main/resources/AlignmentTestData/JR430_JR-P01.ab1 -text
 +eu.etaxonomy.taxeditor.editor/src/main/resources/AlignmentTestData/JR444_JR-P05.ab1 -text
  eu.etaxonomy.taxeditor.editor/src/main/resources/TaonDescriptionEditor.screen -text
 +eu.etaxonomy.taxeditor.editor/src/main/resources/TestPherogram_qualityScore.scf -text
  eu.etaxonomy.taxeditor.editor/src/main/resources/log4j.properties -text
  eu.etaxonomy.taxeditor.editor/src/test/java/eu/etaxonomy/taxeditor/editor/Application.java -text
  eu.etaxonomy.taxeditor.editor/src/test/java/eu/etaxonomy/taxeditor/editor/ApplicationActionBarAdvisor.java -text
@@@ -623,10 -610,12 +625,12 @@@ eu.etaxonomy.taxeditor.editor/src/test/
  eu.etaxonomy.taxeditor.editor/src/test/java/eu/etaxonomy/taxeditor/editor/name/operation/MoveTaxonOperationTest.java -text
  eu.etaxonomy.taxeditor.editor/src/test/java/eu/etaxonomy/taxeditor/editor/name/operation/SwapSynonymAndAcceptedOperationTest.java -text
  eu.etaxonomy.taxeditor.feature.platform/.project -text
+ eu.etaxonomy.taxeditor.feature.platform/LICENSE.TXT -text
  eu.etaxonomy.taxeditor.feature.platform/build.properties -text
  eu.etaxonomy.taxeditor.feature.platform/feature.xml -text
  eu.etaxonomy.taxeditor.feature.platform/pom.xml -text
  eu.etaxonomy.taxeditor.feature/.project -text
+ eu.etaxonomy.taxeditor.feature/LICENSE.TXT -text
  eu.etaxonomy.taxeditor.feature/build.properties -text
  eu.etaxonomy.taxeditor.feature/feature.xml -text
  eu.etaxonomy.taxeditor.feature/pom.xml -text
@@@ -1015,50 -1004,6 +1019,6 @@@ eu.etaxonomy.taxeditor.printpublisher/s
  eu.etaxonomy.taxeditor.printpublisher/src/main/java/eu/etaxonomy/taxeditor/printpublisher/wizard/SelectServiceWizardPage.java -text
  eu.etaxonomy.taxeditor.printpublisher/src/main/java/eu/etaxonomy/taxeditor/printpublisher/wizard/SelectStylesheetWizardPage.java -text
  eu.etaxonomy.taxeditor.printpublisher/src/main/java/eu/etaxonomy/taxeditor/printpublisher/wizard/SelectTaxaWizardPage.java -text
- eu.etaxonomy.taxeditor.remoting/.classpath -text
- eu.etaxonomy.taxeditor.remoting/.project -text
- eu.etaxonomy.taxeditor.remoting/.settings/org.eclipse.jdt.core.prefs -text
- eu.etaxonomy.taxeditor.remoting/.settings/org.eclipse.pde.core.prefs -text
- eu.etaxonomy.taxeditor.remoting/META-INF/MANIFEST.MF -text
- eu.etaxonomy.taxeditor.remoting/build.properties -text
- eu.etaxonomy.taxeditor.remoting/pom.xml -text
- eu.etaxonomy.taxeditor.remoting/src/main/java/eu/etaxonomy/cdm/api/application/CdmApplicationRemoteConfiguration.java -text
- eu.etaxonomy.taxeditor.remoting/src/main/java/eu/etaxonomy/cdm/api/application/CdmApplicationRemoteController.java -text
- eu.etaxonomy.taxeditor.remoting/src/main/java/eu/etaxonomy/cdm/api/cache/CdmServiceCacher.java -text
- eu.etaxonomy.taxeditor.remoting/src/main/java/eu/etaxonomy/cdm/remote/CdmPersistentRemoteSource.java -text
- eu.etaxonomy.taxeditor.remoting/src/main/java/eu/etaxonomy/cdm/remote/CdmRemoteSource.java -text
- eu.etaxonomy.taxeditor.remoting/src/main/java/eu/etaxonomy/cdm/remote/CdmRemoteSourceBase.java -text
- eu.etaxonomy.taxeditor.remoting/src/main/java/eu/etaxonomy/cdm/remote/CdmRemoteSourceException.java -text
- eu.etaxonomy.taxeditor.remoting/src/main/java/eu/etaxonomy/cdm/remote/ICdmRemoteSource.java -text
- eu.etaxonomy.taxeditor.remoting/src/main/java/eu/etaxonomy/taxeditor/remoting/RemotingTestPluginActivator.java -text
- eu.etaxonomy.taxeditor.remoting/src/main/java/org/hibernate/collection/internal/AbstractPersistentCollection.java -text
- eu.etaxonomy.taxeditor.remoting/src/main/java/org/hibernate/proxy/AbstractLazyInitializer.java -text
- eu.etaxonomy.taxeditor.remoting/src/main/resources/etc/jetty/jetty-runner-9.2.3.v20140905.jar -text
- eu.etaxonomy.taxeditor.remoting/src/main/resources/etc/jetty/start-9.2.3.v20140905.jar -text
- eu.etaxonomy.taxeditor.remoting/src/main/resources/eu/etaxonomy/cdm/config.properties -text
- eu.etaxonomy.taxeditor.remoting/src/main/resources/eu/etaxonomy/cdm/httpInvokerServiceClients.xml -text
- eu.etaxonomy.taxeditor.remoting/src/main/resources/eu/etaxonomy/cdm/localApplicationContext.xml -text
- eu.etaxonomy.taxeditor.remoting/src/main/resources/eu/etaxonomy/cdm/remotingApplicationContext.xml -text
- eu.etaxonomy.taxeditor.remoting/src/main/resources/eu/etaxonomy/cdm/remoting_persistence_security.xml -text
- eu.etaxonomy.taxeditor.remoting/src/main/resources/eu/etaxonomy/cdm/remoting_services_security.xml -text
- eu.etaxonomy.taxeditor.remoting/src/test/java/eu/etaxonomy/taxeditor/exception/CDMServerException.java -text
- eu.etaxonomy.taxeditor.remoting/src/test/java/eu/etaxonomy/taxeditor/httpinvoker/BaseRemotingTest.java -text
- eu.etaxonomy.taxeditor.remoting/src/test/java/eu/etaxonomy/taxeditor/httpinvoker/CDMServer.java -text
- eu.etaxonomy.taxeditor.remoting/src/test/java/eu/etaxonomy/taxeditor/httpinvoker/CdmPersistentRemoteSourceTest.java -text
- eu.etaxonomy.taxeditor.remoting/src/test/java/eu/etaxonomy/taxeditor/httpinvoker/CdmRemoteSourceTest.java -text
- eu.etaxonomy.taxeditor.remoting/src/test/java/eu/etaxonomy/taxeditor/httpinvoker/CdmServerTest.java -text
- eu.etaxonomy.taxeditor.remoting/src/test/java/eu/etaxonomy/taxeditor/httpinvoker/HttpInvokerServicesTest.java -text
- eu.etaxonomy.taxeditor.remoting/src/test/java/eu/etaxonomy/taxeditor/lazyloading/AbstractLazyInitializerTest.java -text
- eu.etaxonomy.taxeditor.remoting/src/test/java/eu/etaxonomy/taxeditor/lazyloading/CdmServiceCacherTest.java -text
- eu.etaxonomy.taxeditor.remoting/src/test/java/eu/etaxonomy/taxeditor/lazyloading/RemoteLazyLoadingTest.java -text
- eu.etaxonomy.taxeditor.remoting/src/test/java/eu/etaxonomy/taxeditor/lazyloading/RemotePersistentCollectionTest.java -text
- eu.etaxonomy.taxeditor.remoting/src/test/resources/datasources.xml -text
- eu.etaxonomy.taxeditor.remoting/src/test/resources/eu/etaxonomy/cdm/cdm.datasources.xml -text
- eu.etaxonomy.taxeditor.remoting/src/test/resources/eu/etaxonomy/cdm/testRemotingApplicationContext.xml -text
- eu.etaxonomy.taxeditor.remoting/src/test/resources/eu/etaxonomy/taxeditor/lazyloading/AbstractLazyInitializerTest.xml -text
- eu.etaxonomy.taxeditor.remoting/src/test/resources/h2/cdmTest.h2.db -text
- eu.etaxonomy.taxeditor.remoting/src/test/resources/h2/cdmTest.trace.db -text
- eu.etaxonomy.taxeditor.remoting/src/test/resources/unitils.properties -text
  eu.etaxonomy.taxeditor.store/.classpath -text
  eu.etaxonomy.taxeditor.store/.project -text
  eu.etaxonomy.taxeditor.store/META-INF/MANIFEST.MF -text
@@@ -1099,6 -1044,7 +1059,7 @@@ eu.etaxonomy.taxeditor.store/icons/bina
  eu.etaxonomy.taxeditor.store/icons/bookmark.gif -text
  eu.etaxonomy.taxeditor.store/icons/category.gif -text
  eu.etaxonomy.taxeditor.store/icons/change.gif -text
+ eu.etaxonomy.taxeditor.store/icons/character_data_derivate-16x16-32.png -text
  eu.etaxonomy.taxeditor.store/icons/clear.gif -text
  eu.etaxonomy.taxeditor.store/icons/close.gif -text
  eu.etaxonomy.taxeditor.store/icons/close_view.gif -text
@@@ -1492,6 -1438,7 +1453,7 @@@ eu.etaxonomy.taxeditor.store/src/main/j
  eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/element/MinMaxTextSection.java -text
  eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/element/MultilanguageTextElement.java -text
  eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/element/NumberWithLabelElement.java -text
+ eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/element/OriginalLabelDataElement.java -text
  eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/element/PartialElement.java -text
  eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/element/PointElement.java -text
  eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/element/RootElement.java -text
@@@ -1509,8 -1456,7 +1471,7 @@@ eu.etaxonomy.taxeditor.store/src/main/j
  eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/mvc/AbstractCdmComposite.java -text
  eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/mvc/DerivedUnitGeneralDetailElementMVC.java -text
  eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/mvc/GeographicPointElement.java -text
- eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/mvc/OriginalLabelDataController.java -text
- eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/mvc/OriginalLabelDataElement.java -text
+ eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/mvc/OriginalLabelDataField.java -text
  eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/mvc/combo/EnumTermCombo.java -text
  eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/mvc/combo/EnumTermComboController.java -text
  eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/mvc/element/DateElement.java -text
@@@ -1687,6 -1633,7 +1648,7 @@@ eu.etaxonomy.taxeditor.store/src/main/j
  eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/section/occurrence/derivedUnit/PreservedSpecimenGeneralDetailElement.java -text
  eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/section/occurrence/derivedUnit/PreservedSpecimenGeneralDetailSection.java -text
  eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/section/occurrence/derivedUnit/PreservedSpecimenSourceCollectionDetailSection.java -text
+ eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/section/occurrence/dna/AbstractSampleDesignationDetailSection.java -text
  eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/section/occurrence/dna/AbstractUnboundEntityCollectionSection.java -text
  eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/section/occurrence/dna/AmplificationCloningDetailElement.java -text
  eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/section/occurrence/dna/AmplificationCloningDetailSection.java -text
@@@ -1696,11 -1643,16 +1658,16 @@@ eu.etaxonomy.taxeditor.store/src/main/j
  eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/section/occurrence/dna/AmplificationGeneralDetailSection.java -text
  eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/section/occurrence/dna/AmplificationPrimerDetailElement.java -text
  eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/section/occurrence/dna/AmplificationPrimerDetailSection.java -text
+ eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/section/occurrence/dna/CurrentSampleDesignationDetailSection.java -text
  eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/section/occurrence/dna/DnaQualityDetailElement.java -text
  eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/section/occurrence/dna/DnaQualityDetailSection.java -text
  eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/section/occurrence/dna/DnaSampleGeneralDetailElement.java -text
  eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/section/occurrence/dna/DnaSampleGeneralDetailSection.java -text
  eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/section/occurrence/dna/PrimerGeneralDetailElement.java -text
+ eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/section/occurrence/dna/SampleDesignationDetailElement.java -text
+ eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/section/occurrence/dna/SampleDesignationDetailSection.java -text
+ eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/section/occurrence/dna/SampleDesignationHistoryDetailSection.java -text
+ eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/section/occurrence/dna/SampleDesignationTextDetailElement.java -text
  eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/section/occurrence/dna/SequenceContigFileCollectionDetailSection.java -text
  eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/section/occurrence/dna/SequenceGeneralDetailElement.java -text
  eu.etaxonomy.taxeditor.store/src/main/java/eu/etaxonomy/taxeditor/ui/section/occurrence/dna/SequenceGeneralDetailSection.java -text
index 15fa5be38f8768556325778e282a93c04e3c563f,0718ed6fb01b4e5cbef12f07296c5ac48e55f31c..dc6052e58354e72374afe2c06509a278c4609b13
@@@ -2,7 -2,7 +2,7 @@@ Manifest-Version: 1.
  Bundle-ManifestVersion: 2
  Bundle-Name: Editor Bundle
  Bundle-SymbolicName: eu.etaxonomy.taxeditor.editor;singleton:=true
- Bundle-Version: 3.3.8.qualifier
+ Bundle-Version: 3.4.0.qualifier
  Bundle-Activator: eu.etaxonomy.taxeditor.editor.internal.TaxeditorEditorPlugin
  Bundle-Vendor: %Bundle-Vendor.0
  Bundle-Localization: OSGI-INF/l10n/plugin
@@@ -175,11 -175,4 +175,11 @@@ Bundle-ClassPath: .
   jdimodel.jar,
   pdebuild.jar,
   compatibility.jar,
 - junit.jar
 + junit.jar,
 + lib/biojava3-alignment-3.0.7.jar,
 + lib/biojava3-core-3.0.7.jar,
 + lib/core-1.8.5.jar,
 + lib/sequencing-1.8.5.jar,
 + lib/bioinfweb.commons/,
 + lib/LibrAlign/,
 + lib/commons-lang3-3.1.jar
index 7f039453439c0511918de252ff0d9b96bccd3078,8788f3911b4eea20de1ca748fa26495ea7683b9f..90254eae65b947e6dc43b11b8ee6cf88f9afc98e
              id="eu.etaxonomy.taxeditor.editor.view.checklist.ChecklistEditor"
              name="%editor.name.8">
        </editor>
 +      <editor
 +            class="eu.etaxonomy.taxeditor.editor.molecular.AlignmentEditor"
 +            default="false"
 +            id="eu.etaxonomy.taxeditor.editor.molecular.AlignmentEditor"
 +            name="Alignment Editor">
 +      </editor>
     </extension>
        <extension
              point="org.eclipse.ui.views">
                 </reference>
              </visibleWhen>
           </command>
 +         <command
 +               commandId="eu.etaxonomy.taxeditor.editor.handler.OpenAlignmentEditor"
 +               label="Alignment Editor"
 +               style="push">
 +         </command>
        </menuContribution>
        <menuContribution
              locationURI="menu:org.eclipse.ui.main.menu.navigate">
                 commandId="taxeditor-editor.useExistingImage"
                 label="%command.label.50"
                 style="push">
-             <visibleWhen
-                   checkEnabled="false">
+             <visibleWhen>
                 <reference
                       definitionId="isImageGallery">
                 </reference>
                     <equals
                           value="eu.etaxonomy.taxeditor.editor.view.media">
                     </equals>
-                    <equals
-                          value="eu.etaxonomy.taxeditor.editor.view.derivate.DerivateView">
-                    </equals>
                  </or>
               </with>
            </activeWhen>
        <handler
              class="eu.etaxonomy.taxeditor.editor.handler.OpenChecklistEditorHandler"
              commandId="eu.etaxonomy.taxeditor.editor.handler.OpenChecklistEditorHandler">
-       <handler
 +      </handler>
++            <handler
 +            class="eu.etaxonomy.taxeditor.editor.handler.LoadPherogramHandler"
 +            commandId="eu.etaxonomy.taxeditor.editor.molecular.AlignmentEditor.loadPherogram">
 +         <activeWhen>
 +            <with
 +                  variable="activePartId">
 +               <equals
 +                     value="eu.etaxonomy.taxeditor.editor.molecular.AlignmentEditor">
 +               </equals>
 +            </with>
 +         </activeWhen>
 +      </handler>
 +      <handler
 +            class="eu.etaxonomy.taxeditor.editor.handler.AddAHandler"
 +            commandId="eu.etaxonomy.taxeditor.editor.molecular.AlignmentEditor.addA">
 +         <activeWhen>
 +            <with
 +                  variable="activePartId">
 +               <equals
 +                     value="eu.etaxonomy.taxeditor.editor.molecular.AlignmentEditor">
 +               </equals>
 +            </with>
 +         </activeWhen>
        </handler>
+       <handler
+             class="eu.etaxonomy.taxeditor.editor.view.derivate.handler.DeleteDerivateHandler"
+             commandId="org.eclipse.ui.edit.delete">
+          <activeWhen>
+             <with
+                   variable="activePartId">
+                <equals
+                      value="eu.etaxonomy.taxeditor.editor.view.derivate.DerivateView">
+                </equals>
+             </with>
+          </activeWhen>
+       </handler>
     </extension>
     <extension
           name="%extension.name"
               defaultHandler="eu.etaxonomy.taxeditor.editor.handler.OpenChecklistEditorHandler"
               id="eu.etaxonomy.taxeditor.editor.handler.OpenChecklistViewHandler"
               name="%command.name.38">
 -       </command>
 +      </command>
        <command
              categoryId="eu.etaxonomy.taxeditor.editor.new.category"
              defaultHandler="eu.etaxonomy.taxeditor.view.datasource.handler.CreateDataSourceHandler"
              id="eu.etaxonomy.taxeditor.editor.command.new.datasource"
              name="%command.name.39">
        </command>
 +      <command
 +            defaultHandler="eu.etaxonomy.taxeditor.editor.handler.OpenAlignmentEditor"
 +            id="eu.etaxonomy.taxeditor.editor.handler.OpenAlignmentEditor"
 +            name="Open Alignment Editor">
 +      </command>
 +      <command
 +            id="eu.etaxonomy.taxeditor.editor.molecular.AlignmentEditor.addA"
 +            name="Add A">
 +      </command>
 +      <command
 +            id="eu.etaxonomy.taxeditor.editor.molecular.AlignmentEditor.loadPherogram"
 +            name="Load Pherogram">
 +      </command>
 +
     </extension>
     <extension
           point="org.eclipse.core.expressions.definitions">
              id="eu.etaxonomy.taxeditor.bindings.scheme.default"
              name="%scheme.name">
        </scheme>
 +      <key
 +            commandId="eu.etaxonomy.taxeditor.editor.molecular.AlignmentEditor.addA"
 +            schemeId="eu.etaxonomy.taxeditor.bindings.scheme.default"
 +            sequence="A">
 +      </key>
 +      <key
 +            commandId="eu.etaxonomy.taxeditor.editor.molecular.AlignmentEditor.loadPherogram"
 +            schemeId="eu.etaxonomy.taxeditor.bindings.scheme.default"
 +            sequence="O">
 +      </key>
     </extension>
      <extension
           point="org.eclipse.ui.importWizards">
index ce1c9384d814bba961ad68dc1b5adecbc2f24366,0000000000000000000000000000000000000000..ab3c65165c05a0f9c6ba9c2229459122593c5fa9
mode 100644,000000..100644
--- /dev/null
@@@ -1,218 -1,0 +1,218 @@@
-                                   new File("D:\\Users\\BenStoever\\Documents\\Studium\\Projekte\\Promotion\\EDITor\\Quelltexte\\LibrAlign branch\\Repository\\eu.etaxonomy.taxeditor.editor\\src\\main\\resources\\AlignmentTestData\\JR430_JR-P01.ab1")));
-                       PherogramArea pherogramArea = new PherogramArea(result.getContentArea(), pherogramProvider);
-                       pherogramArea.setFirstSeqPos(1);
-                       pherogramArea.setLeftCutPosition(13);
-                       pherogramArea.setRightCutPosition(697);
-                       pherogramArea.getAlignmentModel().setShiftChange(14, 1);
-                       pherogramArea.getAlignmentModel().setShiftChange(35, 1);
-                       result.getContentArea().getDataAreas().getSequenceAreas(sequenceProvider.sequenceIDByName("Read 1")).add(pherogramArea);
-                       pherogramProvider = new ReverseComplementPherogramProvider(new BioJavaPherogramProvider(ChromatogramFactory.create(
-                               new File("D:\\Users\\BenStoever\\Documents\\Studium\\Projekte\\Promotion\\EDITor\\Quelltexte\\LibrAlign branch\\Repository\\eu.etaxonomy.taxeditor.editor\\src\\main\\resources\\AlignmentTestData\\JR444_JR-P05.ab1"))));
 +// $Id$
 +/**
 +* Copyright (C) 2014 EDIT
 +* European Distributed Institute of Taxonomy
 +* http://www.e-taxonomy.eu
 +*
 +* The contents of this file are subject to the Mozilla Public License Version 1.1
 +* See LICENSE.TXT at the top of this package for the full license terms.
 +*/
 +package eu.etaxonomy.taxeditor.editor.molecular;
 +
 +
 +import info.bioinfweb.commons.bio.biojava3.alignment.SimpleAlignment;
 +import info.bioinfweb.commons.bio.biojava3.alignment.template.Alignment;
 +import info.bioinfweb.commons.bio.biojava3.core.sequence.compound.AlignmentAmbiguityNucleotideCompoundSet;
 +import info.bioinfweb.libralign.AlignmentArea;
 +import info.bioinfweb.libralign.dataarea.implementations.ConsensusSequenceArea;
 +import info.bioinfweb.libralign.dataarea.implementations.SequenceIndexArea;
 +import info.bioinfweb.libralign.dataarea.implementations.pherogram.PherogramArea;
 +import info.bioinfweb.libralign.pherogram.BioJavaPherogramProvider;
 +import info.bioinfweb.libralign.pherogram.PherogramProvider;
 +import info.bioinfweb.libralign.pherogram.ReverseComplementPherogramProvider;
 +import info.bioinfweb.libralign.sequenceprovider.implementations.BioJavaSequenceDataProvider;
 +import info.bioinfweb.libralign.sequenceprovider.tokenset.BioJavaTokenSet;
 +
 +import java.io.File;
 +
 +import org.biojava.bio.chromatogram.ChromatogramFactory;
 +import org.biojava3.core.sequence.DNASequence;
 +import org.biojava3.core.sequence.compound.NucleotideCompound;
 +import org.eclipse.core.runtime.IProgressMonitor;
 +import org.eclipse.swt.SWT;
 +import org.eclipse.swt.widgets.Composite;
 +import org.eclipse.ui.IEditorInput;
 +import org.eclipse.ui.IEditorSite;
 +import org.eclipse.ui.PartInitException;
 +import org.eclipse.ui.part.EditorPart;
 +
 +
 +
 +/**
 + * Editor component to edit a contig alignment used to combine different overlapping pherograms from Sanger sequencing to
 + * a consensus sequence.
 + * <p>
 + * The contained GUI components used to edit the alignment come from <a href="http://bioinfweb.info/LibrAlign/">LibrAlign</a>.
 + *
 + * @author pplitzner
 + * @author Ben Stöver
 + * @date 04.08.2014
 + */
 +public class AlignmentEditor extends EditorPart {
 +    public static final String ID = "eu.etaxonomy.taxeditor.editor.molecular.AlignmentEditor";
 +
 +    private AlignmentArea alignmentArea;
 +
 +
 +      private AlignmentArea createAlignmentArea() {
 +              try {
 +                      //ResourcesPlugin.getWorkspace().getRoot().getFile("/eu.etaxonomy.taxeditor.editor/src/main/resources/TestPherogram_qualityScore.scf");
 +                      //System.out.println(AlignmentEditor.class.getResource("/"));
 +                      //System.out.println(AlignmentEditor.class.getResource("/../resources/TestPherogram_qualityScore.scf"));
 +//                    BioJavaPherogramProvider pherogramProvider = new BioJavaPherogramProvider(ChromatogramFactory.create(
 +//                                    new File("D:\\Users\\BenStoever\\Documents\\Studium\\Projekte\\Promotion\\EDITor\\Quelltexte\\LibrAlign branch\\Repository\\eu.etaxonomy.taxeditor.editor\\src\\main\\resources\\TestPherogram_qualityScore.scf")));
 +                  //TODO Replace this absolute path with a path working with every workspace location.
 +
 +                      Alignment<DNASequence, NucleotideCompound> alignment =
 +                                      new SimpleAlignment<DNASequence, NucleotideCompound>();
 +                      alignment.add("Read 1", new DNASequence("TAAGATACAACAAGGTTTCGGGCA-CCTTATCCACGCAGTAAGGGGATCAGAGGTTTTTCTCTCATTCATGTATCGTGGATCAGTAAGGCAATTTTGCTACCCTGTCTGCTCTTTCTAGCATTTTACTAATGCCCCAGAAATTAGGAATAAAGATTTTATATGAAAGAAAGGGCGAATTAATTCATAAGGGACTGGTATCCATTCTTATTTGATTTGATACATTGTATCCATTAACATTACATTGGCGAATTGGGCGAAGGTGCGGAAAGAGAGGGATTCGAACCCTCGGTAAACAAAAGTCTACATAGCAGTTCCAATGCTACGCCTTGAACCACTCGGCCACCTCTCCTACATAAGGATTTTGGTCCCAAACCAAAAAGAGGGAGTTGTTCAAATTAGATTCTTAGGTAGGTCCGGACAACGAATTCAAATGAATAAGGTAAGGGGACATCCCCCCTCCCTCCCCTTTGTTTTTTTCTTTATTTGGTTAGGGCGGGGGACTCGACTCTTATTGAATTTTCATATGTATCACAGCTCGAAACGAAAGAACTCGTGGGGGGGTCGTTTCCTTTTTGGATCTTGAACGACTAGGTTCAAGAGATGAGAGAATTCAGGATACCCACAAGAAAGACTAATCCAATCCATAACGATGTACCAGAAAAGACAATATTTTTATTACCTGACCA"));
 +                      alignment.add("Read 2", new DNASequence("TAAGATACAACAAGGTTTCGGGCAACCTTATCCACGCAGTAAGGGGATCAGAGGTTTTTCTCTCATTCATGTATCGTGGATCAGTAAGGCAATTTTGCTACCCTGTCTGCTCTTTCTAGCATTTTACTAATGCCCCAGAAATTAGGAATAAAGATTTTATATGAAAGAAAGGGCGAATTAATTCATAAGGGACTGGTATCCATTCTTATTTGATTTGATACATTGTATCCATTAACATTACATTGGCGAATTGGGCGAAGGTGCGGAAAGAGAGGGATTCGAACCCTCGGTAAACAAAAGTCTACATAGCAGTTCCAATGCTACGCCTTGAACCACTCGGCCACCTCTCCTACATAAGGATTTTGGTCCCAAACCAAAAAGAGGGAGTTGTTCAAATTAGATTCTTAGGTAGGTCCGGACAACGAATTCAAATGAATAAGGTAAGGGGACATCCCCCCTCCCTCCCCTTTGTTTTTTTCTTTATTTGGTTAGGGCGGGGGACTCGACTCTTATTGAATTTTCATATGTATCACAGCTCGAAACGAAAGAACTCGTGGGGGGGTCGTTTCCTTTTTGGATCTTGAACGACTAGGTTCAAGAGATGAGAGAATTCAGGATACCCACAAGAAAGACTAATCCAATCCATAACGATGTACCAGAAAAGACAATATTTTTATTACCTGACCA"));
 +                      //alignment.add("Consensus edit 1", new DNASequence("TAAGATACAACAAGGTTTCGGGCAACCTTATCCACGCAGTAAGGGGATCAGAGGTTTTTCTCTCATTCATGTATCGTGGATCAGTAAGGCAATTTTGCTACCCTGTCTGCTCTTTCTAGCATTTTACTAATGCCCCAGAAATTAGGAATAAAGATTTTATATGAAAGAAAGGGCGAATTAATTCATAAGGGACTGGTATCCATTCTTATTTGATTTGATACATTGTATCCATTAACATTACATTGGCGAATTGGGCGAAGGTGCGGAAAGAGAGGGATTCGAACCCTCGGTAAACAAAAGTCTACATAGCAGTTCCAATGCTACGCCTTGAACCACTCGGCCACCTCTCCTACATAAGGATTTTGGTCCCAAACCAAAAAGAGGGAGTTGTTCAAATTAGATTCTTAGGTAGGTCCGGACAACGAATTCAAATGAATAAGGTAAGGGGACATCCCCCCTCCCTCCCCTTTGTTTTTTTCTTTATTTGGTTAGGGCGGGGGACTCGACTCTTATTGAATTTTCATATGTATCACAGCTCGAAACGAAAGAACTCGTGGGGGGGTCGTTTCCTTTTTGGATCTTGAACGACTAGGTTCAAGAGATGAGAGAATTCAGGATACCCACAAGAAAGACTAATCCAATCCATAACGATGTACCAGAAAAGACAATATTTTTATTACCTGACCA"));
 +
 +//                    StringBuffer seqBuffer = new StringBuffer(pherogramProvider.getSequenceLength());
 +//                    for (int i = 1; i <= pherogramProvider.getSequenceLength(); i++) {
 +//                            seqBuffer.append(pherogramProvider.getBaseCall(i).getUpperedBase());
 +//                    }
 +//                    alignment.add("Sequence 4", new DNASequence("-----" + seqBuffer.substring(0, 38) +
 +//                                    seqBuffer.substring(39, 49) + "--" + seqBuffer.substring(49)));  // One A is deleted for shift change specified below.
 +
 +                      BioJavaSequenceDataProvider<DNASequence, NucleotideCompound> sequenceProvider =
 +                                      new BioJavaSequenceDataProvider<DNASequence, NucleotideCompound>(
 +                                                      new BioJavaTokenSet<NucleotideCompound>(
 +                                                                      AlignmentAmbiguityNucleotideCompoundSet.getAlignmentAmbiguityNucleotideCompoundSet(), true),
 +                                                      alignment);
 +
 +                      AlignmentArea result = new AlignmentArea();
 +                      result.getContentArea().setSequenceProvider(sequenceProvider, false);
 +                      SequenceIndexArea sequenceIndexArea = new SequenceIndexArea(result.getContentArea());
 +                      //sequenceIndexArea.setFirstIndex(5);
 +                      //sequenceIndexArea.setHeight(25);
 +                      result.getContentArea().getDataAreas().getTopAreas().add(sequenceIndexArea);
 +
 +//                    PherogramArea pherogramArea = new PherogramArea(result, pherogramProvider);
 +//                    pherogramArea.setFirstSeqPos(34 + 5);
 +//                    pherogramArea.setLeftCutPosition(34);
 +//                    pherogramArea.setRightCutPosition(820);
 +//                    pherogramArea.getAlignmentModel().setShiftChange(38, -1);
 +//                    pherogramArea.getAlignmentModel().setShiftChange(49, 2);
 +//                    result.getDataAreas().getSequenceAreas(sequenceProvider.sequenceIDByName("Sequence 4")).add(pherogramArea);
 +
 +                      PherogramProvider pherogramProvider = new BioJavaPherogramProvider(ChromatogramFactory.create(
++                    new File("/home/pplitzner/svn/LibrAlign/taxeditor/eu.etaxonomy.taxeditor.editor/src/main/resources/AlignmentTestData/JR430_JR-P01.ab1")));
++            PherogramArea pherogramArea = new PherogramArea(result.getContentArea(), pherogramProvider);
++            pherogramArea.setFirstSeqPos(1);
++            pherogramArea.setLeftCutPosition(13);
++            pherogramArea.setRightCutPosition(697);
++            pherogramArea.getAlignmentModel().setShiftChange(14, 1);
++            pherogramArea.getAlignmentModel().setShiftChange(35, 1);
++            result.getContentArea().getDataAreas().getSequenceAreas(sequenceProvider.sequenceIDByName("Read 1")).add(pherogramArea);
++
++            pherogramProvider = new ReverseComplementPherogramProvider(new BioJavaPherogramProvider(ChromatogramFactory.create(
++                new File("/home/pplitzner/svn/LibrAlign/taxeditor/eu.etaxonomy.taxeditor.editor/src/main/resources/AlignmentTestData/JR444_JR-P05.ab1"))));
 +                      pherogramArea = new PherogramArea(result.getContentArea(), pherogramProvider);
 +                      pherogramArea.setFirstSeqPos(1);
 +                      pherogramArea.setLeftCutPosition(267);
 +                      pherogramArea.getAlignmentModel().setShiftChange(273, -1);
 +                      pherogramArea.setVerticalScale(20 * pherogramArea.getVerticalScale());
 +                      result.getContentArea().getDataAreas().getSequenceAreas(sequenceProvider.sequenceIDByName("Read 2")).add(pherogramArea);
 +
 +
 +                  result.getContentArea().getDataAreas().getBottomAreas().add(new ConsensusSequenceArea(result.getContentArea()));
 +                      return result;
 +              }
 +              catch (Exception e) {
 +                      throw new RuntimeException(e);
 +              }
 +
 +//            Alignment<DNASequence, NucleotideCompound> alignment =
 +//                            new SimpleAlignment<DNASequence, NucleotideCompound>();
 +//            alignment.add("Sequence 1", new DNASequence("ATCGTAGATCGTAGATCGTAGATCGTAGATCGTAGATCGTAGATCGTAG"));
 +//            alignment.add("Sequence 2", new DNASequence("AT-GTTG"));
 +//            alignment.add("Sequence 3", new DNASequence("AT-GTAG"));
 +//
 +//            BioJavaSequenceDataProvider<DNASequence, NucleotideCompound> sequenceProvider =
 +//                            new BioJavaSequenceDataProvider<DNASequence, NucleotideCompound>(
 +//                                            new BioJavaTokenSet<NucleotideCompound>(
 +//                                                            AlignmentAmbiguityNucleotideCompoundSet.getAlignmentAmbiguityNucleotideCompoundSet()),
 +//                                            alignment);
 +//
 +//            AlignmentArea result = new AlignmentArea();
 +//            result.setSequenceProvider(sequenceProvider, false);
 +//            SequenceIndexArea sequenceIndexArea = new SequenceIndexArea(result);
 +//            //sequenceIndexArea.setFirstIndex(5);
 +//            //sequenceIndexArea.setHeight(25);
 +//            result.getDataAreas().getTopAreas().add(sequenceIndexArea);
 +//            result.getDataAreas().getBottomAreas().add(new ConsensusSequenceArea(result));
 +//            return result;
 +      }
 +
 +
 +    /* (non-Javadoc)
 +     * @see org.eclipse.ui.part.WorkbenchPart#createPartControl(org.eclipse.swt.widgets.Composite)
 +     */
 +    @Override
 +    public void createPartControl(Composite parent) {
 +      alignmentArea = createAlignmentArea();
 +              Composite alignmentWidget = alignmentArea.createSWTWidget(parent, SWT.NONE);
 +              //getSite().setSelectionProvider(provider)
 +    }
 +
 +
 +    /* (non-Javadoc)
 +     * @see org.eclipse.ui.part.EditorPart#doSave(org.eclipse.core.runtime.IProgressMonitor)
 +     */
 +    @Override
 +    public void doSave(IProgressMonitor monitor) {
 +        // TODO Auto-generated method stub
 +
 +    }
 +
 +
 +    /* (non-Javadoc)
 +     * @see org.eclipse.ui.part.EditorPart#doSaveAs()
 +     */
 +    @Override
 +    public void doSaveAs() {
 +        // TODO Auto-generated method stub
 +
 +    }
 +
 +
 +    /* (non-Javadoc)
 +     * @see org.eclipse.ui.part.EditorPart#init(org.eclipse.ui.IEditorSite, org.eclipse.ui.IEditorInput)
 +     */
 +    @Override
 +    public void init(IEditorSite site, IEditorInput input) throws PartInitException {
 +        setSite(site);
 +        setInput(input);
 +    }
 +
 +
 +    /* (non-Javadoc)
 +     * @see org.eclipse.ui.part.EditorPart#isDirty()
 +     */
 +    @Override
 +    public boolean isDirty() {
 +        // TODO Auto-generated method stub
 +        return false;
 +    }
 +
 +
 +    /* (non-Javadoc)
 +     * @see org.eclipse.ui.part.EditorPart#isSaveAsAllowed()
 +     */
 +    @Override
 +    public boolean isSaveAsAllowed() {
 +        // TODO Auto-generated method stub
 +        return false;
 +    }
 +
 +
 +    /* (non-Javadoc)
 +     * @see org.eclipse.ui.part.WorkbenchPart#setFocus()
 +     */
 +    @Override
 +    public void setFocus() {
 +      //alignmentArea.getToolkitComponent().redistributeHeight();
 +    }
 +}